circad | circRNAs associated with diseases

CircRNA_104916
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink		PMID	30844715
Experimental Method
Sample Type	Tissue and cell lines	Comparison	The human CRC samples, and their paired adjacent noncancerous specimen were collected from 116 patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCTCGGTGACCTTGGTCTGG Reverse GCGTGTTGGGATGCCTCTGT	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Min, L, Wang, H, Zeng, Y (2019). CircRNA_104916 regulates migration, apoptosis and epithelial-mesenchymal transition in colon cancer cells. Front Biosci (Landmark Ed), 24:819-832.